Tailless

Tailless Recombinant Nucleosome with Linker DNA, Biotinylated

$475.00
SKU: 16-2027
Pack Size: 50 μg
  • Species:  Human
  • Source:  E. coli & synthetic DNA
  • Tag:  Biotinylated
  • Molecular Weight:  215,300 Da

Description

Recombinant mononucleosomes consist of 199 base pairs of DNA wrapped around an octamer core of histone proteins (two each of H2A, H2B, H3.1, and H4) to form a nucleosome, the basic repeating unit of chromatin. The 5’ biotin-TEG DNA consists of a core 147 bp 601 nucleosome assembly sequence [1] flanked by 26 bp linker sequences as underlined below. After assembly, histone tails were enzymatically removed. This product is ideal for use as a negative control in binding assays and pull-down experiments.

Validation Data

Figure 1: Protein gel data
Coomassie stained SDS-PAGE gel of proteins in Tailless Nucleosome (1 μg) demonstrates the purity of histones in the preparation. Lane 1: Histone proteins in the nucleosome before enzymatic removal of tails. Sizes of molecular weight markers and positions of the intact core histones (H2A, H2B, H3, and H4) are indicated. Lane 2: Histone proteins in the nucleosome after tail removal via trypsin-digestion. Heterogeneity of the trypsin-treated histone proteins can be observed.

Figure 2: DNA gel data
Tailless Nucleosomes resolved via native PAGE and stained with ethidium bromide to visualize DNA. All lanes are from the same gel. Lane 1: Free DNA (EpiCypher 18-2044; 100 ng). Lane 2: Intact nucleosomes (400 ng). Lane 3: Nucleosomes after enzymatic removal of histone tails.

Technical Information

Storage
Stable for six months at -80°C from date of receipt. For best results, aliquot and avoid freeze/thaws.
Formulation
10 mM Tris-HCl pH 7.5, 25 mM NaCl, 1 mM EDTA, 2 mM DTT, 20% glycerol. (21.4 μg protein, 50 μg DNA + protein).

Application Notes

Tailless Recombinant Nucleosome with Linker DNA is highly purified and suitable for use as a negative control or substrate in enzyme screening assays and nucleosome binding experiments. The biotinylated DNA enables affinity binding applications.

DNA Sequence

5’Bio-TEG
GGACCCTATACGCGGCCGCCGAATTCCTGGAGAATCCCGGTCTGCAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGGATCCGCCGGTCGCGAACAGCGACC3’

Gene & Protein Information

UniProt ID

H2A - P04908 (alt. names: H2A type 1-B/E, H2A.2, H2A/a, H2A/m)

H2B - O60814 (alt. names: H2B K, HIRA-interacting protein 1)

H3.1 - P68431 (alt. names: H3, H3/a, H3/b, H3/c, H3/d)

H4 - P62805

References

Background References:
[1] Lowary & Widom J. Mol. Biol. (1998). PMID: 9514715

Documents & Resources

Current stock: 0