EpiDyne®

EpiDyne® Remodeling Assay Substrate DNA ST601-GATC0, Biotinylated

$115.00
SKU: 18-4110
Pack Size: 50 µg

Description

EpiDyne® Remodeling Assay Substrate DNA ST601-GATC0 is a 217 base-pair double-stranded DNA fragment containing the 601 nucleosome positioning sequence [1], which has high affinity for histone octamers and is useful for nucleosome assembly. The DNA also includes a 3’ acceptor sequence to accommodate the histone octamer subsequent to remodeling. This negative control does not contain DpnII restriction sites. When paired with the positive control DNA (Catalog No. 18-4111) these controls illustrate the migration range for the Restriction Enzyme Assay. See the EpiDyne Nucleosome Remodeling Assay Tech Note (Restriction Enzyme Assay) for more information view our Technical Notes.

Validation Data

Figure 1: DNA Gel Data
ST601-GATC0 DNA resolved via native PAGE gel and stained with ethidium bromide to visualize DNA. Lane 1: Free DNA (200 ng). Lane 2: Free DNA incubated with 10U DpnII for 1 hr at 37°C (200 ng). Lane 3: Free DNA incubated with 10U MfeI for 1 hr at 37°C (200 ng). Migration patterns of DNA molecular weight markers are indicated.

Technical Information

Formulation
50 µg lyophilized ST601-GATC0 DNA.
Storage and Stability
Stable for six 2 years at -20°C from date of receipt. After resuspending, aliquots should be stored at -80°C.

Application Notes

ST601-GATC0 DNA is useful as a negative control for restriction enzyme accessibility nucleosome remodeling assays using the EpiDyne Remodeling Assay Substrate. No DpnII restriction enzyme site is present, while the naturally occurring MfeI (AATTGG in bold) remains present within the 601 sequence.

DNA Sequence

GAATTCATCAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGAC AGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTT AACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATAT ATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATG ATGGATGAATAGATGGATGGATGAAGCTT

References

Background References:
[1] Lowary & Widom J. Mol. Biol. (1998). PMID: 9514715

Documents & Resources

Current stock: 0