Mononucleosomes,

Mononucleosomes, Recombinant, Hemi-methylated 199x601 DNA, Biotinylated

$575.00
SKU: 16-2043
Pack size: 50 µg
Select Pack Size *
Mononucleosomes, Recombinant, Hemi-methylated 199x601 DNA, Biotinylated Description: Mononucleosomes assembled from recombinant histones expressed in E. coli (two each of histones H2A, H2B, H3 and H4; accession numbers: H2A-P06897; H2B-P02281; H3-Q92133; H4-P62799) wrapped by 199 base pairs of DNA containing the 601 positioning sequence DNA. The the 199 bp DNA sequence contains a 147 base-pair 601 nucleosome positioning sequence. The 601 sequence is flanked by a hemi-methylated 26 bp sequence as shown in application notes and contains a 5' biotin-TEG group.

Mononucleosomes, Recombinant, Hemi-methylated 199x601 DNA, Biotinylated Formulation: Mononucleosomes, Recombinant, 199x601 DNA (50 µg DNA + protein, 24.3 µg protein weight) in 10 mM Tris pH 7.5, 25 mM NaCl, 1 mM EDTA, 2 mM EDTA, 20% glycerol. MW = 231,964.24 Da.

Mononucleosomes, Recombinant, Hemi-methylated 199x601 DNA, Biotinylated Storage and Stability: Stable for six months at -80°C from date of receipt. For best results, aliquot and avoid multiple freeze/thaws.

Mononucleosomes, Recombinant, Hemi-methylated 199x601 DNA, Biotinylated Application Notes:

DNA sequence with methylation sites in RED

5'-Biotin-TEG'-GGACCCTATACGCGGCCGCCGAATTCCTGGAGAATCCCG
GTCTGCAGGCCGCTCAATTGGTCGTAGACAGCTCTACGTGGC
GAATTTGCGTGCATGCGCCTGTCCCCCGCGTTTTAACCGCCA
AGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATAC
ATCCTGTGGATCCGCCGGTCGCGAACAGCGACC-3'

3'-CCTGGGATATGCGCCGGCGGCTTAAGGACCTCTTAGGGCCAGACGT
CCGGCGAGTTAACCAGCATCTGTCGAGATGCACCGCTTAAAC
GCACGTACGCGGACAGGGGGCGCAAAATTGGCGGTTCCCCT
AATGAGGGATCAGAGGTCCGTGCACAGTCTATATATGTAGGACA
CCTAGGCGGCCAGCGCTTGTCGCTGG-5'

References:


View technical datasheet for this product. 16-2043 Datasheet

16-2043 Protein Gel
Protein Gel Data: Coomassie stained PAGE gel of proteins in Mononucleosomes, Recombinant, Hemi-methylated 199x601 DNA, Biotinylated (0.75 µg) to demonstrate the purity of the histones in the preparation. Sizes of molecular weight markers and positions of the core histones (H2A, H2B, H3 and H4) are indicated.
(Click image to enlarge)

16-2043 DNA Gel
DNA Gel Data: Mononucleosomes, Recombinant, Hemi-methylated 199x601 DNA, Biotinylated run on a native PAGE gel and stained with ethidium bromide to visualize DNA. Lane 1: Free DNA. Lane 2: Intact nucleosomes (200 ng).
(Click image to enlarge)
Current stock: 0