EpiDyne

EpiDyne® Remodeling Assay Substrate DNA ST601-GATC1,2, Biotinylated

$115.00
SKU: 18-4112
Pack Size: 50 µg
EpiDyne Remodeling Assay Substrate DNA ST601-GATC1,2, Biotinylated Description: EpiDyne Remodeling Assay Substrate DNA ST601-GATC1,2, Biotinylated is a 217 base-pair double-stranded DNA fragment containing a 5' biotin-TEG group. This sequence includes the Lowary 601 nucleosome positioning sequence (see 18-0005) as well as a 3' acceptor sequence to accomodate the histone octamer subsequent to remodeling. ST601-GATC1,2, Biotinylated DNA has a restriction enzyme sites embedded in the 601 sequence that are accessible after nucleosome remodeling.

EpiDyne Remodeling Assay Substrate DNA ST601-GATC1,2, Biotinylated Formulation: 50 µg lyophilyzed ST601-GATC1,2, Biotinylated DNA.

EpiDyne Remodeling Assay Substrate DNA ST601-GATC1,2, Biotinylated Storage and Stability: Stable for 2 years at -20°C from date of receipt. After resuspending, aliquots should be stored at -80°C.

EpiDyne Remodeling Assay Substrate DNA ST601-GATC1,2, Biotinylated Application Notes: EpiDyne Remodeling Assay Substrate DNA ST601-GATC1,2, Biotinylated is useful as a control for restriction enzyme accessibility nucleosome remodeling assays using the EpiDyne Remodeling Assay Substrate, as a DpnII restriction enzyme site is present within the 601 sequence.

DNA Sequence: GAATTCATCAGAATCCCGGTGCCGAGGCCGATCAATTGATCGTAGACAGCTCTAGCACCGCTTAA
ACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCAC
GTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGATGGATG
AATAGATGGATGGATGAAGCTT

References:
Lowary PT and J Widom (1998). J Mol Biol 276: 19-42. Link

View technical datasheet for this product. 18-4112 Datasheet

18-4112 Gel Data

DNA Gel Data: Lane 1: EpiDyne Remodeling Assay Substrate DNA ST601-GATC1,2, Biotinylated (200ng) and Lane2: EpiDyne Remodeling Assay Substrate DNA ST601-GATC1,2, Biotinylated (200 ng) digested with 10U DpnII incubated at 37C for 1 hour resolved via native PAGE. Migration positions of DNA molecular weight markers are indicated.
(Click image to enlarge)

Current stock: 0