EpiDyne®

EpiDyne® Remodeling Assay Substrate DNA ST601-GATC0

$115.00
SKU: 18-4100
Pack Size: 50 µg
EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 Description: EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 is a 217 base-pair double-stranded DNA fragment. This sequence includes the Lowary 601 nucleosome positioning sequence (see 18-0005) as well as a 3' acceptor sequence to accomodate the histone octamer subsequent to remodeling.
EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 Formulation: 50 µg lyophilyzed ST601-GATC0 sequence DNA.

EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 Storage and Stability: Stable for 2 years at -20°C from date of receipt. After resuspending, aliquots should be stored at -80°C.

EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 Application Notes: EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 is useful as a negative control for restriction enzyme accessibility nucleosome remodeling assays using the EpiDyne Remodeling Assay Substrate. No restriction enzyme site is present.

DNA Sequence: GAATTCATCAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCACCGCTTAA
ACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCAC
GTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGATGGATG
AATAGATGGATGGATGAAGCTT

References:
Lowary PT and J Widom (1998). J Mol Biol 276: 19-42. Link

View technical datasheet for this product. 18-4100 Datasheet

18-4100 Gel Data

DNA Gel Data: EpiDyne Remodeling Assay Substrate DNA ST601-GATC0 (200 ng) run on a 1.8% TBE agarose gel. Migration positions of DNA molecular weight markers are indicated.
(Click image to enlarge)

Current stock: 0